.. Squiggle documentation master file, created by sphinx-quickstart on Thu Jul 5 23:24:54 2018. You can adapt this file completely to your liking, but it should at least contain the root `toctree` directive. Squiggle ======== |Build Status| |Cov| |CodeFactor| |Docs| |PyPI| Squiggle is a two-dimensional DNA sequence visualization library that can turn FASTA sequence files like this: .. code-block:: text >lcl|NC_000011.10_cds_NP_000509.1_1 [gene=HBB] ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAG TTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGG GGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGT GCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACT GTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCA TCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAAT GCCCTGGCCCACAAGTATCACTAA into gorgeous, interactive visualizations like this: .. raw:: html :file: figures/human_hbb.html Installation ------------ If you don't have Python 3.4 or greater installed, be sure to `get it `_. To get the current stable version of Squiggle, run:: $ pip install squiggle Or, alternatively, if you want to get the latest development version:: $ pip install git+https://github.com/Lab41/squiggle.git Usage ----- Using Squiggle is as easy as:: $ squiggle your_sequence.fasta Squiggle has tons of options available to make beautiful, interactive visualizations of DNA sequences. To get a full rundown of the various option, take a look at the :ref:`guide`. Citation -------- To be determined! Table of Contents ----------------- .. toctree:: :maxdepth: 2 methods user_guide api cli license Indices and tables ------------------ * :ref:`genindex` * :ref:`modindex` * :ref:`search` .. |Build Status| image:: https://travis-ci.org/Lab41/squiggle.svg?branch=master :target: https://travis-ci.org/Lab41/squiggle .. |Cov| image:: https://codecov.io/gh/Lab41/squiggle/branch/master/graph/badge.svg :target: https://codecov.io/gh/Lab41/squiggle .. |Docs| image:: http://readthedocs.org/projects/freqgen/badge/?version=latest :target: http://squiggle.readthedocs.io/en/latest/?badge=latest .. |CodeFactor| image:: https://www.codefactor.io/repository/github/Lab41/squiggle/badge :target: https://www.codefactor.io/repository/github/Lab41/squiggle/ .. |PyPI| image:: https://img.shields.io/pypi/v/squiggle.svg :target: https://pypi.org/project/squiggle/